Timme, Lukas Theodor; Henschen, Helena; Puerto Rueda, Diana N; Manda, Sneha; Parkinson, John Everett; Wild, Christian; Abramovich, Sigal; Morard, Raphael; Schmidt, Christiane: qPCR before and after bleaching and after symbiont switing in the foraminifera Sorites orbiculus [dataset]. PANGAEA, https://doi.pangaea.de/10.1594/PANGAEA.984044 (dataset in review), In: Timme, LT et al.: Menthol-DCMU bleaching and re-inoculation of Symbiodiniaceae in the large benthic foraminifera Sorites orbiculus [dataset bundled publication]. PANGAEA, https://doi.pangaea.de/10.1594/PANGAEA.984033 (dataset in review)
Abstract:
The uptake of novel Symbiodiniaceae strains in Sorites orbiculus was measured using qPCR. To facilitate novel algae uptake, the specimens were bleached for 27 days with 0.19 mmol L-1 menthol and 5 µmol L-1 DCMU, followed by 19 days of re-inoculation with the Symbiodinium microadriaticum (strains KB8 and CCMP2467) and Fugacium kawagutii (strain F2) individually and collectively at a concentration of 1e5 cells ml-1 and a further observation for 37 days to verify long-term establishment of symbiosis. The primer pairs S.S.ITS2F (5′- TTCTGCTGCTCTTGTTATCAGG− 3′) and S.S.ITS2R (5′- ACACACATGAGCTTTTGTTTCG− 3′) were used and qPCR measurements were performed before the start of the experiment, after the bleaching experiment and after the symbiosis stability evaluation.
Funding:
Deutsche Forschungsgemeinschaft, Bonn (DFG), grant/award no. 444059848: SYMBIOAID: the role of diatom endosymbionts on the adaptive potenital of benthic foraminifera to climate change
Coverage:
Latitude: 29.501812 * Longitude: 34.917251
Date/Time Start: 2023-06-26T00:00:00 * Date/Time End: 2023-06-26T00:00:00
Event(s):
S_orbiculus_2023 * Latitude: 29.501812 * Longitude: 34.917251 * Date/Time Start: 2023-06-26T00:00:00 * Date/Time End: 2023-06-26T00:00:00 * Location: Gulf of Aqaba * Method/Device: Sampling by snorkeling (SNORKELING) * Comment: sampling depth: 2 m; sample location: Inter-University Institute for Marine Sciences
Comment:
Symbiodinium microadriaticum, strain CCMP2467: collected in the Gulf of Aquaba on 2004-07-30, symbiont isolated from Stylophora pistillata
Symbiodinium microadriaticum, strain KB8: collected in Hawaii, symbiont isolated from Cassiopaia xamancha
Fugacium kawagutii, strain F2: collected in Jamaica, Caribbean, symbiont isolated from Meandrina meandrites
ASW: artificial seawater
Parameter(s):
| # | Name | Short Name | Unit | Principal Investigator | Method/Device | Comment |
|---|---|---|---|---|---|---|
| 1 | Experimental treatment | Exp treat | Timme, Lukas Theodor | |||
| 2 | Type of study | Study type | Timme, Lukas Theodor | |||
| 3 | Date/Time, sample preparation | Date/Time prep | Timme, Lukas Theodor | Fixation date of samples | ||
| 4 | Experimental condition | Exp condition | Timme, Lukas Theodor | |||
| 5 | Method comment | Method comm | Timme, Lukas Theodor | |||
| 6 | Specimen number | Spec no | Timme, Lukas Theodor | |||
| 7 | Surface area | SA | µm2 | Timme, Lukas Theodor | Specimen | |
| 8 | Gene copies | GCN | # | Timme, Lukas Theodor | ||
| 9 | Density | Density | arbitrary units | Timme, Lukas Theodor | Gene density per cm**2 |
License:
Creative Commons Attribution 4.0 International (CC-BY-4.0) (License comes into effect after moratorium ends)
Size:
1332 data points